Review



dc temperature regulation system  (fhc inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    fhc inc dc temperature regulation system
    Dc Temperature Regulation System, supplied by fhc inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dc+temperature+regulation+system/dc+temperature+regulation+system/pm38678557-167-25-29
    Average 90 stars, based on 1 article reviews
    dc temperature regulation system - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Ointment:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Saline:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Electron Microscopy:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Adhesive:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Sterility:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Temperature Regulation:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Article Title: jULIEs: extracellular probes for recordings and stimulation in the structurally and functionally intact mouse brain
    Article Snippet: For surgery, mice were anaesthetized with isoflurane (3% induction followed by 2% maintenance), and fixed on a stereotaxic apparatus (Model 940, David Kopf instruments, Germany) using ear bars. .. Body temperature was maintained at 36 °C with a DC temperature regulation system (FHC, Inc. USA). ..

    Article Title: Higher-order thalamocortical circuits are specified by embryonic cortical progenitor types in the mouse brain.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BamHI-Flpo-Fwr: CTGCAGAAGGATTCGCC GCCACCATGGCTCCTAAGAAGAAGAGGA Sigma Aldrich N/A PmeI-Flpo-Rev: ATGACGTCGTTTAAACTC AGATCCGCCTGTTGATGTAG Sigma Aldrich N/A AscI-eGFPRev-Fwr: GAGAACGGCGCGCC TTACTTGTACAGCTCGTCCATGC Sigma Aldrich N/A NheI-eGFPFwr-Rev: GAGACCGCTAGCG CCACCATGGTGAGCAAGG Sigma Aldrich N/A Recombinant DNA Ta1-Cre (Stancik et al.)39 N/A Ta1-Flpo This paper N/A pCAG-Flpo (Xue et al.)91 http://net.addgene:60662; RRID; Addgene 60662 Tbr2-Flpo This paper N/A CAG-GFP (Zhao et al.)92 http://n2t.net/addgene:16664; RRID:Addgene_16664 pAAV-CAG-iCre (Druckmann et al.)93 http://n2t.net/addgene:51904; RRID:Addgene_51904 Glast-Cre (Stancik et al.)39 N/A CAG-LoxP-GFP Edward Boyden http://n2t.net/addgene:28304; RRID:Addgene_28304 CAG-LoxP-TdTom Edward Boyden http://n2t.net/addgene:28306; RRID:Addgene_28306 CAG-FRT-TdTom This paper N/A pAAV-CAG-fDIO-mNeonGreen (Chan et al.)94 http://n2t.net/addgene:99133; RRID:Addgene_99133 pCAG-mNaChBac-T2A-tdTomato (Xue et al.)91 http://n2t.net/addgene:60650; RRID:Addgene_60650 CAG-FRT-GFP This paper N/A EF1a-LoxP-ChR2-YFP Karl Deisseroth http://n2t.net/addgene:20298; RRID:Addgene_20298 CAG-LoxP-tdTomato/GFP (Franco et al.)58 N/A CAG-Lhx2 This paper N/A TetO-FUW-Lhx2 (Cassady et al.)95 http://n2t.net/addgene:61537; RRID:Addgene_61537 CAG-LoxP-Lhx2 This paper N/A Software and algorithms MATLAB (version 2020a) Mathworks RRID:SCR_001622 Python (version 3.7.0) Open source RRID:SCR_008394 http://www.python.org pClamp Molecular Devices RRID:SCR_011323 WinWCP University of Strathclyde RRID:SCR_014713 Zen Digital Imaging for Light Microscopy Carl Zeiss RRID:SCR_013672 Open Ephys Open Ephys Production Site https://open-ephys.org FIJI (Schindelin et al.)96 RRID:SCR_002285 ImageJ (Schneider et al.)97 RRID:SCR_002285 Neurolucida 360 MBF Bioscience RRID:SCR_016788 Kilosort (Pachitariu et al.)98 RRID:SCR_016422 https://github.com/cortex-lab/Kilosort Phy Cyrille Rossant https://github.com/cortex-lab/phy/ (Continued on next page) 16 Cell Reports 43, 114157, May 28, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Other 5mm platinum Tweezertrode BTX Cat# 45-0489 ECM 830 Pulse Generator BTX Cat# ECM-830 473 nm LED LedEngin Cat# 905-3870 DC temperature regulation system FHC inc Cat# 40-90-8D Pneumatic dental drill Foredom Cat# H.MH-170 32-channel electrode Neuronexus Cat# A32 - Rev 3.3 Mouse stereotaxic frame Stoelting Cat# 51730 Mouse stereotaxic frame Kopf Cat# 963 Vibrating microtome Microm Cat# HMV650V Aquisition board OpenEphys N/A PulsePal OpenEphys N/A Piezoelectric bending actuator Piezo Technics N/A Piezo controller Piezo Technics N/A RHD2132 amplifier Intan Cat# RHD2132 NPD36 connector Omnetics Cat# NPD36 Vicryl Ethicon W9500T Prolene Ethicon W8890 Injection micropipettes Blaubrand intraMARK Cat# BR708707-1000EA 1.5 mm outer diameter borosilicate capillaries Warner Instruments Cat# 64-0793 1.2 mm outer diameter borosilicate capillaries Warner Instruments Cat# 64-0790 ..

    Imaging:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Microscopy:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    In Vivo Imaging:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    In Vivo:

    Article Title: In Vivo Microendoscopy of the Hippocampus
    Article Snippet: .. Reagents Agarose, Type III-A (Sigma-Aldrich) Analgesic (e.g., buprenorphine) Anti-inflammatory (e.g., carprofen, dexamethasone) (optional; see Step 10) Artificial cerebrospinal fluid (ACSF; e.g., from Harvard Apparatus) Dental acrylic (e.g., Ortho-Jet, Lang Dental Manufacturing Co., Inc.) Ethanol (70%) Local anesthetic (e.g., 1% lidocaine) as needed (see Step 13) Ophthalmic ointment (e.g., Puralube Vet Ointment, PharmaDerm/Nycomed US) Physiologic saline or lactated Ringer’s solution (e.g., from Electron Microscopy Sciences) Skin disinfectant (e.g., betadine, Baxter) Tissue adhesive (e.g., Vetbond, 3 M) Equipment Balance (for weighing animals; e.g., Mettler Toledo International, Inc.) Capillary tubing (e.g., thin-walled glass 1.0–2.5-mm inner diameter, Vitrocom, Inc.) Cold light source (e.g., KL 1500, SCHOTT North America, Inc.) Connection bar (metal) and adaptors Containers to store guide tubes (e.g., sterile culture dishes) Cotton swabs Coverslips (#0 thickness; e.g., from Electron Microscopy Sciences) Curing light (e.g., COLTOLUX 75, Coltène Whaledent) DC temperature regulation system (e.g., FHC Inc. 40-90-8; 40-90-5; 40-90-2-07) Diamond-scribing tool (e.g., from Electron Microscopy Sciences) Gel foam (optional; see Step 18) Glass bead sterilizer (e.g., model BS-500, Dent-EQ) Gloves Heating blanket Imaging setup: Microscope that has infinity optics and that has been adapted for in vivo imaging (e.g., Ultima IV, Prairie Technologies, Inc.) Microendoscope probe Microscope objectives for optical coupling to the microendoscope probe For a detailed description of the components, see In Vivo Optical Microendoscopy for Imaging Cells Lying Deep within Live Tissue ( Barretto and Schnitzer 2012 ). ..

    Injection:

    Article Title: Higher-order thalamocortical circuits are specified by embryonic cortical progenitor types in the mouse brain.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BamHI-Flpo-Fwr: CTGCAGAAGGATTCGCC GCCACCATGGCTCCTAAGAAGAAGAGGA Sigma Aldrich N/A PmeI-Flpo-Rev: ATGACGTCGTTTAAACTC AGATCCGCCTGTTGATGTAG Sigma Aldrich N/A AscI-eGFPRev-Fwr: GAGAACGGCGCGCC TTACTTGTACAGCTCGTCCATGC Sigma Aldrich N/A NheI-eGFPFwr-Rev: GAGACCGCTAGCG CCACCATGGTGAGCAAGG Sigma Aldrich N/A Recombinant DNA Ta1-Cre (Stancik et al.)39 N/A Ta1-Flpo This paper N/A pCAG-Flpo (Xue et al.)91 http://net.addgene:60662; RRID; Addgene 60662 Tbr2-Flpo This paper N/A CAG-GFP (Zhao et al.)92 http://n2t.net/addgene:16664; RRID:Addgene_16664 pAAV-CAG-iCre (Druckmann et al.)93 http://n2t.net/addgene:51904; RRID:Addgene_51904 Glast-Cre (Stancik et al.)39 N/A CAG-LoxP-GFP Edward Boyden http://n2t.net/addgene:28304; RRID:Addgene_28304 CAG-LoxP-TdTom Edward Boyden http://n2t.net/addgene:28306; RRID:Addgene_28306 CAG-FRT-TdTom This paper N/A pAAV-CAG-fDIO-mNeonGreen (Chan et al.)94 http://n2t.net/addgene:99133; RRID:Addgene_99133 pCAG-mNaChBac-T2A-tdTomato (Xue et al.)91 http://n2t.net/addgene:60650; RRID:Addgene_60650 CAG-FRT-GFP This paper N/A EF1a-LoxP-ChR2-YFP Karl Deisseroth http://n2t.net/addgene:20298; RRID:Addgene_20298 CAG-LoxP-tdTomato/GFP (Franco et al.)58 N/A CAG-Lhx2 This paper N/A TetO-FUW-Lhx2 (Cassady et al.)95 http://n2t.net/addgene:61537; RRID:Addgene_61537 CAG-LoxP-Lhx2 This paper N/A Software and algorithms MATLAB (version 2020a) Mathworks RRID:SCR_001622 Python (version 3.7.0) Open source RRID:SCR_008394 http://www.python.org pClamp Molecular Devices RRID:SCR_011323 WinWCP University of Strathclyde RRID:SCR_014713 Zen Digital Imaging for Light Microscopy Carl Zeiss RRID:SCR_013672 Open Ephys Open Ephys Production Site https://open-ephys.org FIJI (Schindelin et al.)96 RRID:SCR_002285 ImageJ (Schneider et al.)97 RRID:SCR_002285 Neurolucida 360 MBF Bioscience RRID:SCR_016788 Kilosort (Pachitariu et al.)98 RRID:SCR_016422 https://github.com/cortex-lab/Kilosort Phy Cyrille Rossant https://github.com/cortex-lab/phy/ (Continued on next page) 16 Cell Reports 43, 114157, May 28, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Other 5mm platinum Tweezertrode BTX Cat# 45-0489 ECM 830 Pulse Generator BTX Cat# ECM-830 473 nm LED LedEngin Cat# 905-3870 DC temperature regulation system FHC inc Cat# 40-90-8D Pneumatic dental drill Foredom Cat# H.MH-170 32-channel electrode Neuronexus Cat# A32 - Rev 3.3 Mouse stereotaxic frame Stoelting Cat# 51730 Mouse stereotaxic frame Kopf Cat# 963 Vibrating microtome Microm Cat# HMV650V Aquisition board OpenEphys N/A PulsePal OpenEphys N/A Piezoelectric bending actuator Piezo Technics N/A Piezo controller Piezo Technics N/A RHD2132 amplifier Intan Cat# RHD2132 NPD36 connector Omnetics Cat# NPD36 Vicryl Ethicon W9500T Prolene Ethicon W8890 Injection micropipettes Blaubrand intraMARK Cat# BR708707-1000EA 1.5 mm outer diameter borosilicate capillaries Warner Instruments Cat# 64-0793 1.2 mm outer diameter borosilicate capillaries Warner Instruments Cat# 64-0790 ..



    Similar Products

    dc temperature regulation system  (fhc inc)
    90
    fhc inc dc temperature regulation system
    Dc Temperature Regulation System, supplied by fhc inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dc+temperature+regulation+system/dc+temperature+regulation+system/pm38678557-167-25-29
    Average 90 stars, based on 1 article reviews
    dc temperature regulation system - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    feedback-regulated homeothermic blanket dc temperature controller  (Stoelting inc)
    90
    Stoelting inc feedback-regulated homeothermic blanket dc temperature controller
    Feedback Regulated Homeothermic Blanket Dc Temperature Controller, supplied by Stoelting inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dc+temperature+regulation+system/feedback+regulated+homeothermic+blanket+dc+temperature+controller/pmc08428512-52-12-17
    Average 90 stars, based on 1 article reviews
    feedback-regulated homeothermic blanket dc temperature controller - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    dc-0506 circulatory temperature regulator  (Tauto Biotech Co. Ltd)
    90
    Tauto Biotech Co. Ltd dc-0506 circulatory temperature regulator
    Dc 0506 Circulatory Temperature Regulator, supplied by Tauto Biotech Co. Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dc+temperature+regulation+system/constant+temperature+circulating+device/pmc06222705-60-13-18
    Average 90 stars, based on 1 article reviews
    dc-0506 circulatory temperature regulator - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    dc-0506 constant temperature regulator  (Shanghai Sanotac Scientific)
    90
    Shanghai Sanotac Scientific dc-0506 constant temperature regulator
    Dc 0506 Constant Temperature Regulator, supplied by Shanghai Sanotac Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dc+temperature+regulation+system/dc+0506+constant+temperature+regulator/10__1556_slash_1326__2017__29407-59-1-21
    Average 90 stars, based on 1 article reviews
    dc-0506 constant temperature regulator - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    fisher dc-10 temperature regulator  (Thermo Fisher)
    90
    Thermo Fisher fisher dc-10 temperature regulator
    Fisher Dc 10 Temperature Regulator, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dc+temperature+regulation+system/10__1002_slash_app__34651-52-15-13
    Average 90 stars, based on 1 article reviews
    fisher dc-10 temperature regulator - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results